The exact function of human gasdermin-B (GSDMB), which regulates differentiation and growth of epithelial cells, is yet to be elucidated. In human epidermal growth factor receptor 2 (HER2)-positive breast cancer, GSDMB gene amplification and protein overexpression indicate a poor response to HER2-targeted therapy. Genome-wide association studies revealed a correlation between GSDMB SNPs and an increased susceptibility to Crohn’s disease, ulcerative colitis, and asthma. The N- and C-terminal domains of all gasdermins possess lipid-binding and regulatory activities, respectively. Inflammatory caspases cleave gasdermin-D in the interdomain linker but not GSDMB. The cleaved N-terminal domain binds phosphoinositides and cardiolipin, forms membrane-disrupting pores, and executes pyroptosis. We show that both full-length GSDMB and the N-terminal domain bind to nitrocellulose membranes immobilized with phosphoinositides or sulfatide, but not with cardiolipin. In addition, the GSDMB N-terminal domain binds liposomes containing sulfatide. The crystal structure of the GSDMB C-terminal domain reveals the structural impact of the amino acids encoded by SNPs that are linked to asthma and inflammatory bowel disease (IBD). A loop that carries the polymorphism amino acids corresponding to healthy individuals (Gly299:Pro306) exhibits high conformational flexibility, whereas the loop carrying amino acids found in individuals with increased disease risk (Arg299:Ser306) exhibits a well-defined conformation and higher positive surface charge. Apoptotic executioner caspase-3, -6, and -7, but not the inflammatory caspases, cleave GSDMB at 88DNVD91 within the N-terminal domain. Selective sulfatide binding may indicate possible function for GSDMB in the cellular sulfatide transport.

Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5′AAACATGTTT3′) and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5′AAACATGTTTTAAAACATGTTT3′). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer–dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded Kd = 11.7 μM for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability.